Primer Detail
- Primer name
- Aci-T22
- Gene name
- Beta-tubulin (TUB2)
- Primer sequence (5'-3')
- TCTGGATATTGTTGGGGATCC
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- Aci-T1
- Reference
- Tanaka E, Hosoe T, Degawa Y, et al. (2021) Revision of the genus Aciculosporium (Clavicipitaceae) with a description of a new species on wavyleaf basketgrass, and proline-containing cyclic dipeptide production by A. take. Mycoscience 62: 166–175.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
Aciculosporium oplismeni MAFF 246966 Aciculosporium sasicola MAFF 247297 Aciculosporium take MAFF 241224 Claviceps litoralis MAFF 247555 Claviceps palustris MAFF 247552, MAFF 247554 Claviceps panicoidearum MAFF 247571 Claviceps queenslandica MAFF 306124 Claviceps yanagawaensis MAFF 247556