Primer Detail
- Primer name
- Aci-T1
- Gene name
- Beta-tubulin (TUB2)
- Primer sequence (5'-3')
- ACAATGCGTGAGATTGTGAGT
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- Aci-T22
- Reference
- Tanaka E, Hosoe T, Degawa Y, et al. (2021) Revision of the genus Aciculosporium (Clavicipitaceae) with a description of a new species on wavyleaf basketgrass, and proline-containing cyclic dipeptide production by A. take. Mycoscience 62: 166–175.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
Aciculosporium sasicola MAFF 246967, MAFF 247298 Aciculosporium take MAFF 241223 Claviceps kawatanii MAFF 247558 Claviceps oplismeni MAFF 247568 Claviceps palustris MAFF 247553 Claviceps panicoidearum MAFF 247570 Claviceps queenslandica MAFF 247574 Claviceps tandae MAFF 247313