Primer Detail
- Primer name
- M4565-R
- Gene name
- A fragment of the mini chromosome maintenance complex 7 gene (Mcm7)
- Primer sequence (5'-3')
- TGTTCCATGACTTCGTGGAT
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- CARCA-F
- Reference
- van der Linde EJ, Píchová K, Pažoutová S, et al. (2022) Pre-invasion assessment on African invasive grasses revealed five new species of ergot fungi, Claviceps section Pusillae. Fungal Biology 126: 752–763.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
Claviceps agropyri MAFF 247569 Claviceps phragmitis MAFF 247551