Primer Detail
- Primer name
- CAL-CL2A
- Gene name
- Calmodulin (CaM)
- Primer sequence (5'-3')
- TTTTTGCATCATGAGTTGGAC
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- CAL-CL1 CAL-228F
- Reference
- O'Donnell K., Nirenberg H.I., Aoki T., Cigelnik, E. (2000) A multigene phylogeny of the Gibberella fujikuroi species complex: detection of additional phylogenetically distinct species. Mycoscience 41: 61–78.
- Literature
- Crous, P.W., et al. (more than 150 authors) (2021) Fusarium: more than a node or a foot-shaped basal cell. Studies in Mycology 98: 1-184.