PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
CAL-228F
CAL228F
Gene name
calmodulin (CAL)
Primer sequence (5'-3')
GAGTTCAAGGAGGCCTTCTCCC
Direction
F
Target
filamentous ascomycetes
Paired primer
CAL-CL2A CAL-2Rd
Reference
Carbone I, Kohn LM (1999) A method for designing primer sets for speciation studies in filamentous ascomycetes. Mycologia 91: 553-556.
Literature
Crous PW, Groenewald JZ, Pongpanich K, Himaman W, Arzanlou M and Wingfield MJ (2004) Cryptic speciation and host specificity among Mycosphaerella spp. occurring on Australian Acacia species grown as exotics in the tropics. Studies in Mycology 50: 457-469.
Avila de la Calle A, Groenewald JZ, Trapero A and Crous PW (2005) Characterization and epitypification of Pseudocercospora cladosporioides, the causal organism of Cercospora leaf spot of olives. Mycological Research 109(8): 881-888.
Crous PW, Groenewald JZ, Risède J-M, Simoneau P and Hywel-Jones NL (2004) Calonectria species and their Cylindrocladium anamorphs: species with sphaeropedunculate vesicles. Studies in Mycology 50: 415-430.
Pedro W Crous, Johannes Z Groenewald, Marizeth Groenewald, Pat Caldwell, Uwe Braun and Thomas C Harrington (2006) Species of Cercospora associated with grey leaf spot of maize. Studies in Mycology 55: 189-197.
Groenewald JZ, Nakashima C, Nishikawa J, Shin HD, Park JH, Jama AN, Groenewald M, Braun U and Crous PW (2013) Species concepts in Cercospora: spotting the weeds among the roses. Studies in Mycology 75: 115-170.
Groenewald M, Groenewald JZ and Crous PW (2005) Distinct species exist within the Cercospora apii morphotype. Phytopathology 95: 951-959.
Stukenbrock EH, Quaedvlieg W, Javan-Nikhah M, Zala M, Crous PW, (2012) Zymoseptoria ardabilia and Z. pseudotritici, two progenitor species of the septoria tritici leaf blotch fungus Z. tritici (synonym: Mycosphaerella graminicola). Mycologia 104: 1397-1407.
Quaedvlieg W, Kema GHJ, Groenewald JZ, Verkley GJM, Seifbarghi S, Razavi M, Gohari A, Mirzadi, Mehrabi R and Crous PW (2011) Zymoseptoria gen. nov.: a new genus to accommodate Septoria-like species occurring on graminicolous hosts. Persoonia 26: 57-69.
L Lombard, PW Crous, BD Wingfield and MJ Wingfield (2010) Phylogeny and systematics of the genus Calonectria. Studies in Mycology 66: 31-69.
Amselem J, Cuomo CA, van Kan JA, Viaud M, Benito EP, Couloux A, Coutinho PM, de Vries RP, Dyer PS, Fillinger S, Fournier E, Gout L, Hahn M, Kohn L, Lapalu N, Plummer KM, Pradier JM, Quévillon E, Sharon A, Simon A, ten Have A, Tudzynski B, Tudzynski P, Wincker P, Andrew M, Anthouard V, Beever RE, Beffa R, Benoit I, Bouzid O, Brault B, Chen Z, Choquer M, Collémare J, Cotton P, Danchin EG, Da Silva C, Gautier A, Giraud C, Giraud T, Gonzalez C, Grossetete S, Güldener U, Henrissat B, Howlett BJ, Kodira C, Kretschmer M, Lappartient A, Leroch M, Levis C, Mauceli E, Neuvéglise C, Oeser B, Pearson M, Poulain J, Poussereau N, Quesneville H, Rascle C, Schumacher J, Ségurens B, Sexton A, Silva E, Sirven C, Soanes DM, Talbot NJ, Templeton M, Yandava C, Yarden O, Zeng Q, Rollins JA, Lebrun MH and Dickman M (2011) Genomic analysis of the necrotrophic fungal pathogens Sclerotinia sclerotiorum and Botrytis cinerea. PLoS Genetics 7: e1002230.
Collado-Romero M, Mercado-Blanco J, Olivares-García C and Jiménez-Díaz RM (2008) Phylogenetic analysis of Verticillium dahliae vegetative compatibility groups. Phytopathology 98: 1019-1028.
Reference Strain
Cercospora apiiIMI 077043, IMI 161116, MAFF 235978, MAFF 238072, MAFF 238299
Cercospora begoniaeMAFF 237690
Cercospora beticolaMAFF 238206, MAFF 305036
Cercospora capsiciMAFF 238227
Cercospora citrullinaMAFF 237872, MAFF 237913, MAFF 238205
Cercospora corchoriMAFF 238191
Cercospora ipomoeaeMAFF 239409
Cercospora kikuchiiMAFF 305039, MAFF 305040
Cercospora lactucae-sativaeMAFF 237719, MAFF 238209
Cercospora psophocarpicolaMAFF 305757
Cercospora richardiicolaMAFF 238210
Cercospora vignigenaMAFF 237635
Cercospora zinniaeMAFF 237718
Lasiodiplodia theobromaeMAFF 238880