Primer Detail
- Primer name
- AML2
- Gene name
- SSU
- Primer sequence (5'-3')
- GAACCCAAACACTTTGGTTTCC
- Direction
- R
- Paired primer
- NS31 AML1
- Reference
- Lee J, Lee S and Young JP (2008) Improved PCR primers for the detection and identification of arbuscular mycorrhizal fungi. FEMS Microbiology Ecology 65: 339-349.
- Literature
- Davison J, Öpik M, Zobel M, Vasar M, Metsis M and Moora M (2012) Communities of arbuscular mycorrhizal fungi detected in forest soil are spatially heterogeneous but do not vary throughout the growing season. PLoS One 7: e41938.