Primer Detail
- Primer name
- NS31
- Gene name
- 18S rRNA gene (SSU)
- Primer sequence (5'-3')
- TTGGAGGGCAAGTCTGGTGCC
- Direction
- F
- Paired primer
- AML2
- Reference
- Simon L, Lalonde M and Bruns TD (1992) Specific amplification of 18S ribosomal genes from VA endomycorrhizal fungi colonizing roots. Applied and Environmental Microbiology 58: 291-295.
- Literature
- Valášková V and Baldrian P (2009) Denaturing gradient gel electrophoresis as a fingerprinting method for the analysis of soil microbial communities. JournalPlant, Soil and Environment 55(10): 413-423.
- Kowalchuk GA, de Souza FA and van Veen JA (2002) Community analysis of arbuscular mycorrhizal fungi associated with Ammophila arenaria in Dutch coastal sand dunes. Molecular Ecology 11: 571-581.
- Helgason T, Daniell TJ, Husband R, Fitter AH and Young JP (1998) Ploughing up the wood-wide web ?. Nature 394: 431.
- Davison J, Öpik M, Zobel M, Vasar M, Metsis M and Moora M (2012) Communities of arbuscular mycorrhizal fungi detected in forest soil are spatially heterogeneous but do not vary throughout the growing season. PLoS One 7: e41938.