Primer Detail
- Primer name
- Pa1
- Gene name
- ITS
- Primer sequence (5'-3')
- TCCACGTGAACCGTTGAAATC
- Direction
- F
- Category
- specific primer
- Paired primer
- ITS2
- Reference
- PH Wang, YT Wang and JG White (2003) Species-specific PCR primers for Pythium developed from ribosomal ITS1 region. Letters in Applied Microbiology 37: 127-132.
- Literature
- Schroeder KL, Martin F, de Cock AWAM, Lévesque CA, Spies C Okubara P and Paulitz TC (2013) Molecular detection and quantification of Pythium species - Evolving taxonomy, new tools and challenges. Plant Disease 97: 4-20.