Primer Detail
- Primer name
- ITS2
ITS 2 backward
- Gene name
- ITS1-5.8S-ITS2 rRNA gene (ITS)
- Primer sequence (5'-3')
- GCTGCGTTCTTCATCGATGC
- Direction
- R
- Paired primer
- Pac1 Pa1 Par1 Phe1 Pinf1 Pint1 Pir1 Pmy5 Po1 Pro1 Pspl1 Pspi1 Psu3 ITS1FI2 Pa3 Pgr1 Phy1 Psu1 Pto1 Pus1 Pva1
- Reference
- White, T. J., Bruns, T., Lee, S. and Taylor, J. (1990) Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols: A Guide to Methods and Applications, eds. Innis, M. A., D. H. Gelfand, J. J. Sninsky, and T. J. White. Academic Press, Inc., New York. 315-322.
- Literature
- Annette Kretzer, Yunan Li, Timothy Szaro and Thomas D. Bruns (1996) Internal transcribed spacer sequences from 38 recognized species of Suillus sensu lato: Phylogenetic and taxonomic implications. Mycologia 88(5): 776-785.
- K.A. Seifert, S.J. Hughes, H. Boulay and G. Louis-Seize (2007) Taxonomy, nomenclature and phylogeny of three cladosporium-like hyphomycetes, Sorocybe resinae, Seifertia azaleae and the Hormoconis anamorph of Amorphotheca resinae. Studies in Mycology 58: 235-245.
- Gargas, A. P.T. DePriest and J.W. Taylor (1995) Positions of multiple insertions in SSU rDNA of lichen-forming fungi. Molecular Biology and Evolution 12: 208-218.
- http://www.lutzonilab.net/primers/page244.shtml
- Leena Myllys, Katileena Lohtander, Mari Källersjö and Anders Tehler (1999) Sequence insertion and ITS data provide congruent information in Roccella canariensis and R. tuberculata (Arthoniales, Euascomycetes) phylogeny. Molecular Phylogenetics and Evolution 12: 295-309.
- Valášková V and Baldrian P (2009) Denaturing gradient gel electrophoresis as a fingerprinting method for the analysis of soil microbial communities. JournalPlant, Soil and Environment 55(10): 413-423.
- Anderson IC, Campbell CD and Prosser JI (2003) Diversity of fungi in organic soils under a moorland ? Scots pine (Pinus sylvestris L.) gradient. Environmental Microbiology 5: 1121-1132.
- Panelli S. Buffoni JN, Bonacina C and Feligini M (2012) Identification of moulds from the Taleggio cheese environment by the use of DNA barcodes. Food Control 28: 385-391.
- Sterflinger K and Prillinger H (2001) Molecular taxonomy and biodiversity of rock fungal communities in an urban environment (Vienna, Austria). Antonie Van Leeuwenhoek 80: 275-286.
- Rouxel M, Mestre P, Comont G, Lehman BL, Schilder A, Delmotte F (2013) Phylogenetic and experimental evidence for host-specialized cryptic species in a biotrophic oomycete. New Phytologist 197: 251-263.
- Matheny PB, Wang Z, Binder M, Curtis JM, Lim YW, Nilsson RH, Hughes KW, Hofstetter V, Ammirati JF, Schoch CL, Langer E, Langer G, McLaughlin DJ, Wilson AW, Frøslev T, Ge ZW, Kerrigan RW, Slot JC, Yang ZL, Baroni TJ, Fischer M, Hosaka K, Matsuura K, Seidl MT, Vauras J and Hibbett DS (2007) Contributions of rpb2 and tef1 to the phylogeny of mushrooms and allies (Basidiomycota, Fungi). Molecular Phylogenetics and Evolution 43: 430-451.
- Johanson A, Turner HC, McKay GJ and Brown AE (1998) A PCR-based method to distinguish fungi of the rice sheath-blight complex, Rhizoctonia solani, R. oryzae and R. oryzae-sativae. FEMS Microbiology Letters 15: 289-294.
- Peter Bonants, Marjanne Hagenaar-de Weerdt, Marga van Gent-Pelzer, Isabelle Lacourt, David Cooke and Jim Duncan (1997) Detection and Identification of Phytophthora fragariae Hickman by the Polymerase Chain Reaction. European Journal of Plant Pathology 103: 345-355.
- Guido Schnabel, Joshua S Ash and Patricia K Bryson (2005) Identification and characterization of Armillaria tabescens from the southeastern United States. Mycological Research 109: 1208-1222.
- Mohammad Ziaur Rahman, Hiroyuki Mukobata, Haruhisa Suga and Koji Kageyama (2014) Phytophthora asiatica sp. nov., a new species causing leaf and stem blight of kudzu in Japan. Mycological Progress 13: 759-769.
- Bakkeren G, Kronstad JW and Lévesque CA (2000) Comparison of AFLP fingerprints and ITS sequences as phylogenetic markers in Ustilaginomycetes. Mycologia 92: 510-521.
- Toju H, Tanabe AS, Yamamoto S and Sato H (2012) High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PLoS One 6: e40863.
- Schroeder KL, Martin F, de Cock AWAM, Lévesque CA, Spies C Okubara P and Paulitz TC (2013) Molecular detection and quantification of Pythium species - Evolving taxonomy, new tools and challenges. Plant Disease 97: 4-20.
- Philipp-André Schmidt, Miklós Bálint, Bastian Greshake, Cornelia Bandow, Jörg Römbke and Imke Schmitt (2013) Illumina metabarcoding of a soil fungal community. Soil Biology and Biochemistry 65: 128-132.
- Klemsdal SS, Herrero ML, Wanner LA, Lund G and Hermansen A (2008) PCR-based identification of Pythium spp. causing cavity spot in carrots and sensitive detection in soil samples. Plant pathology 57: 877-886.
- Kawamura Y, Yokoo K, Tojo M and Hishiike M (2005) Distribution of Pythium porphyrae, the Causal Agent of Red Rot Disease of Porphyrae spp., in the Ariake Sea, Japan. Plant Disease 89: 1041-1047.
