Primer Detail
- Primer name
- CLA-F
- Gene name
- 28S rRNA gene (LSU)
- Primer sequence (5'-3')
- GCATATCAATAAGCGGAGGA
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- CLA-R
- Reference
- Currie CR, Wong B, Stuart AE, et al. (2003) Ancient tripartite coevolution in the attine ant-microbe symbiosis. Science 299: 386–388.
- Literature
- Montoya QV, Martiarena MJS, Rodrigues A (2023) Taxonomy and systematics of the fungus-growing ant associate Escovopsis (Hypocreaceae). Studies in Mycology 106: 349–397.