Primer Detail
- Primer name
- EF6–20F
- Gene name
- translation elongation factor 1 alpha (tef1)
- Primer sequence (5'-3')
- AAGAACATGATCACTGGTACCT
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- EF6–1000R
- Reference
- Taerum SJ, Cafaro MJ, Little AEF, et al. (2007) Low host-pathogen specificity in the leaf-cutting ant-microbe symbiosis. Proceedings of the Royal Society B: Biological Sciences 274: 1971–1978.
- Literature
- Montoya QV, Martiarena MJS, Rodrigues A (2023) Taxonomy and systematics of the fungus-growing ant associate Escovopsis (Hypocreaceae). Studies in Mycology 106: 349–397.