Primer Detail
- Primer name
- fRPB2-7cR-Cla
- Gene name
- polymerase second largest subunit (RPB2)
- Primer sequence (5'-3')
- CCCATGGCCTGCTTACCCAT
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- fRPB2-5F-Cla
- Reference
- Tanaka E, Shrestha B, Shivas RG (2020) Commelinaceomyces, gen. nov., for four clavicipitaceous species misplaced in Ustilago that infect Commelinaceae. Mycologia 112: 649–660.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
Claviceps miscanthicola MAFF 247559 Claviceps sorghicola MAFF 247566