Primer Detail
- Primer name
- Tub2.5R
- Gene name
- Beta-tubulin (TUB2)
- Primer sequence (5'-3')
- CCGTAAGAGGGGTTGGACAG
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Reference
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
