Primer Detail
- Primer name
- LR5+
- Gene name
- The internal transcribed spacer and the large subunit regions (ITS-LSU)
- Primer sequence (5'-3')
- ACTGCTATCCTGAGGGAAACTTCG
- Category
- specific primer
- Target
- fungi
- Reference
- Vilgalys R, Hester M (1990) Rapid genetic identification and mapping of enzymatically amplified ribosomal DNA from several Cryptococcus species. Journal of Bacteriology 172: 4238–4246.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
Claviceps agropyri MAFF 247547 Claviceps phragmitis MAFF 247549