Primer Detail
- Primer name
- LR2SM
- Gene name
- The internal transcribed spacer and the large subunit regions (ITS-LSU)
- Primer sequence (5'-3')
- CCTCTTTTCAAAGTGCTTTTC
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- LR2RSM
- Reference
- Sullivan RF, Bills GF, Hywel-Jones NL, White JF Jr. (2000) Hyperdermium: a new clavicipitalean genus for some tropical epibionts of dicotyledonous plants. Mycologia 92: 908–918.
- Literature
- Tanaka E, Tanada K, Hosoe T, Shrestha B, Kolařík M, Liu M (2023) In search of lost ergots: phylogenetic re-evaluation of Claviceps species in Japan and their biogeographic patterns revealed. Studies in Mycology 106: 1–39.
- Reference Strain
Claviceps africana MAFF 247564 Claviceps paspali MAFF 247572