Primer Detail
- Primer name
- ERIC2
- Gene name
- Internal Transcribed Spacer (ITS)
- Primer sequence (5'-3')
- AAGTAAGTGACTGGGGTGAGCG
- Category
- specific primer
- Target
- fungi
- Reference
- Karimi E, Safaie N, Shams-bakhsh M. (2011) Assessment of genetic diversity among Sclerotinia sclerotiorum populations in canola fields by REP-PCR. Trakia Journal of Sciences 9: 62–68.
- Literature
- Hahuly MV, Sumardiyono C, Wibowo A, et al. (2018) Identification of purple blotch pathogen of shallot by PCR using specific primer for Alternaria genus. Archives of Phytopathology and Plant Protection 51: 103–121.