Primer Detail
- Primer name
- 18SRVEU
- Gene name
- Internal Transcribed Spacer (ITS)
- Primer sequence (5'-3')
- TCCAACTACGAGCTTTTTAACTGC
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- 18SFWEU
- Reference
- Pavón MA, González I, Rojas M, Pegels N, Martín R, García T. (2011) PCR detection of Alternaria spp. in processed foods, based on the Internal Transcribed Spacer genetic marker. Journal of Food Protection 74: 240–247.
- Literature
- Hahuly MV, Sumardiyono C, Wibowo A, et al. (2018) Identification of purple blotch pathogen of shallot by PCR using specific primer for Alternaria genus. Archives of Phytopathology and Plant Protection 51: 103–121.