Primer Detail
- Primer name
- CA14
- Gene name
- γ-actin (ACT)
- Primer sequence (5'-3')
- AACTGGGATGACATGGAGAAGATCTGGC
- Direction
- R
- Target
- fungi
- Paired primer
- CA5R
- Reference
- Daniel HM, Sorrell TC, Meyer W. (2001) Partial sequence analysis of the actin gene and its potential for studying the phylogeny of Candida species and their teleomorphs. International Journal of Systematic and Evolutionary Microbiology 51: 1593–1606.
- Literature
- Stielow, J.B. et al. (65 authors) (2015) One fungus, which genes? Development and assessment of universal primers for potential secondary fungal DNA barcodes. Persoonia 35: 242–263.
- Daniel HM, Meyer W. (2003) Evaluation of ribosomal RNA and actin gene sequences for the identification of ascomycetous yeast. International Journal of Food Microbiology 86: 61–78.