Primer Detail
- Primer name
- RPB2-LasR
- Gene name
- polymerase second largest subunit (RPB2)
- Primer sequence (5'-3')
- GCGCAAATACCCAGAATCAT
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- RPB2-LasF
- Reference
- Cruywagen, E. M., Slippers, B., Roux, J., and Wingfield, M. J. (2017) Phylogenetic species recognition and hybridization in Lasiodiplodia: A case study on species from baobabs. Fungal Biology 121: 420-436.
- Literature
- Zhang, W., Groenewald, J.Z., Lombard, L., Schumacher, R.K., Phillips, A.J.L., Crous, P.W. (2021) Evaluating species in Botryosphaeriales. Persoonia 46: 63–115.