Primer Detail
- Primer name
- Prv8-F
- Gene name
- (Prv8)
- Primer sequence (5'-3')
- GTTCTCATTAATTCTTGTTGA
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- Prv8-R
- Reference
- Martin, F.N. (2008) Mitochondrial haplotype determination in the oomycete plant pathogen Phytophthora ramorum. 54: 23–34.
- Literature
- Jung, T., Jung, M.H. , Webber, J.F., et al. (21 authors) (2021) The destructive tree pathogen Phytophthora ramorum originates from the Laurosilva forests of East Asia. Journal of Fungi 7: 226 (32pp.).