Primer Detail
- Primer name
- Phy10b
- Gene name
- the cytochrome c oxidase subunits 2 with the spacer between 1 and 2 (cox2 + spacer)
- Primer sequence (5'-3')
- GCAAAAGCACTAAAAATTAAATATAA
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- FM35
- Reference
- Martin, F.N. (2008) Mitochondrial haplotype determination in the oomycete plant pathogen Phytophthora ramorum. 54: 23–34.
- Literature
- Jung, T., Jung, M.H. , Webber, J.F., et al. (21 authors) (2021) The destructive tree pathogen Phytophthora ramorum originates from the Laurosilva forests of East Asia. Journal of Fungi 7: 226 (32pp.).
