Primer Detail
- Primer name
- FM80RC
- Gene name
- the cytochrome c oxidase subunits 1 (cox1)
- Primer sequence (5'-3')
- TTTCAACAAATCATAAAGATATT
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- FM85
- Reference
- Martin, F.N., Tooley, P.W. (2003) Phylogenetic relationships among Phytophthora species inferred from sequence analysis of mitochondrially encoded cytochrome oxidase I and II genes. Mycologia 95: 269–284.
- Literature
- Jung, T., Jung, M.H. , Webber, J.F., et al. (21 authors) (2021) The destructive tree pathogen Phytophthora ramorum originates from the Laurosilva forests of East Asia. Journal of Fungi 7: 226 (32pp.).