Primer Detail
- Primer name
- HSP90F1
- Gene name
- heat shock protein 90 (hsp90)
- Primer sequence (5'-3')
- GCTGGACACGGACAAGAACC
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- HSP90R1
- Reference
- Blair, J.E., Coffey, M.D., Park, S.-Y., Greiser, D.M., Kang, S. (2008) A multi-locus phylogeny for Phytophthora utilizing markers derived from complete genome sequences. 45: 266–277.
- Literature
- Jung, T., Jung, M.H. , Webber, J.F., et al. (21 authors) (2021) The destructive tree pathogen Phytophthora ramorum originates from the Laurosilva forests of East Asia. Journal of Fungi 7: 226 (32pp.).