Primer Detail
- Primer name
- PrRXLR121_-244F
- Gene name
- putative effector (Avh121)
- Primer sequence (5'-3')
- CATGCTGACCCATTCAGTACC
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- PrRXLR121_623R
- Reference
- Goss, E.M., Carbone, I., Grünwald, N.J. (2009) Ancient isolation and independent evolution of the three clonal lineages of the exotic sudden oak death pathogen Phytophthora ramorum. Molecular Ecology 18: 1161–1174.
- Literature
- Jung, T., Jung, M.H. , Webber, J.F., et al. (21 authors) (2021) The destructive tree pathogen Phytophthora ramorum originates from the Laurosilva forests of East Asia. Journal of Fungi 7: 226 (32pp.).