Primer Detail
- Primer name
- g352/R
- Gene name
- ATPase gene (g352)
- Primer sequence (5'-3')
- CTACATCAGACTGCTGCGCG
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- g352/F
- Reference
- Zhang, Y., Cao, Q., Hu, P., Cui, H., Yu, X., Ye, Z (2017) Investigation on the differentiation of two Ustilago esculenta strains - implications of a relationship with the host phenotypes appearing in the fields. BMC Microbiology 17: 228.