Primer Detail
- Primer name
- bW3/R
- Gene name
- mating type gene of b3 (bW3)
- Primer sequence (5'-3')
- TGATCAGCAGAGACATCGAGAG
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- bW3/F
- Reference
- Zhang, Y., Cao, Q., Hu, P., Cui, H., Yu, X., Ye, Z (2017) Investigation on the differentiation of two Ustilago esculenta strains - implications of a relationship with the host phenotypes appearing in the fields. BMC Microbiology 17: 228.