Primer Detail
- Primer name
- M-ITS 1
- Gene name
- ITS (ITS)
- Primer sequence (5'-3')
- GGTGAACCTGCAGATGGATC
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Reference
- Stoll, M., Piepenbring, M., Begerow, D. and Oberwinkler, F. (2003) Molecular phylogeny of Ustilago and Sporisorium species (Basidiomycota, Ustilaginales) based on internal transcribed spacer (ITS) sequences. Cannadian Journal of Botany 81: 976-984.
- Literature
- Stoll, M., Piepenbring, M., Begerow, D. and Oberwinkler, F. (2003) Molecular phylogeny of Ustilago and Sporisorium species (Basidiomycota, Ustilaginales) based on internal transcribed spacer (ITS) sequences. Cannadian Journal of Botany 81: 976-984.