Primer Detail
- Primer name
- Mat1M72F
- Gene name
- The 3f end of apn2 and the 5f end of the mating type gene Mat1-2 (Mat1/Apn2)
- Primer sequence (5'-3')
- ACGGCAAACGGCTCAGGGAGTG
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Paired primer
- Mat1M72R
- Reference
- Crouch, J.A., Tredway, L.P., Clarke, B.B., Hillman, B.I. (2009) Phylogenetic and population genetic divergence correspond with habitat for the pathogen Colletotrichum cereale and allied taxa across diverse grass communities. Molecular Ecology 18: 123–135.
- Literature
- Liu, F., Ma, Z.Y., Hou, L.W., Diao, Y.Z., Wu, W.P., Damm, U., Song, S. and Cai, L. (2022) Updating species diversity of Colletotrichum, with a phylogenomic overview. Studies in Mycology 101: 1–56.
- Reference Strain
Colletotrichum hanaui MAFF 305404 Colletotrichum nicholsonii MAFF 511115 Colletotrichum paspali MAFF 305403 Colletotrichum zoysiae MAFF 238573, MAFF 238574, MAFF 238576 Fusarium mori MAFF 238538, MAFF 238539 Fusarium oligoseptatum MAFF 246283