PriMicro Database

For classification, identification and molecular phylogenetic analyses of microbes

Primer Detail

Primer name
AMR1
Gene name
Apn2-Mat1-2 intergenic spacer and partial mating type Mat1-2 gene (ApMat)
Primer sequence (5'-3')
TCATTCTACGTATGTGCCCG
Direction
R
Category
specific primer
Target
fungi
Paired primer
AMF1
Reference
Silva, D.N., Talhinhas, P., Várzea, V., Cai, L. (2012) Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia 104: 396–409.
Literature
Liu, F., Ma, Z.Y., Hou, L.W., Diao, Y.Z., Wu, W.P., Damm, U., Song, S. and Cai, L. (2022) Updating species diversity of Colletotrichum, with a phylogenomic overview. Studies in Mycology 101: 1–56.
Yokosawa, S., Eguchi, N., Kondo, K. and Sato, T. (2017) Phylogenetic relationship and fungicide sensitivity of members of the Colletotrichum gloeosporioides species complex from apple. Journal of General Plant Pathology 83: 291–298.
Yokosawa, S., Eguchi, N. and Sato, T. (2020) Characterization of the Colletotrichum gloeosporioides species complex causing grape ripe rot in Nagano Prefecture, Japan. Journal of General Plant Pathology 86: 163–172.
Reference Strain
Colletotrichum aenigmaMAFF 244310
Colletotrichum fructicolaMAFF 244305, MAFF 244312, MAFF 244313, MAFF 244314, MAFF 244317, MAFF 244669, MAFF 244670, MAFF 244671, MAFF 244672, MAFF 244673, MAFF 244674, MAFF 244675, MAFF 246972, MAFF 246973, MAFF 246979, MAFF 246980, MAFF 246983, MAFF 246984
Colletotrichum perseaeMAFF 246969, MAFF 246971, MAFF 246974, MAFF 246975, MAFF 246977, MAFF 246978, MAFF 246981, MAFF 246982, MAFF 246988
Colletotrichum siamenseMAFF 244304, MAFF 244306, MAFF 244307, MAFF 244308, MAFF 244309, MAFF 244316, MAFF 244676, MAFF 244677
Colletotrichum sp.MAFF 244315, MAFF 246970, MAFF 246976, MAFF 246985, MAFF 246989, MAFF 246990, MAFF 246993, MAFF 246995, MAFF 246996
Colletotrichum viniferumMAFF 246968, MAFF 246986, MAFF 246987, MAFF 246991, MAFF 246992, MAFF 246994