Primer Detail
- Primer name
- Apn1W1R
- Gene name
- Mat1 and the adjacent DNA lyase gene (apn2)
- Primer sequence (5'-3')
- GCGGAGCAGAGGATGTAGTC
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- Apn1W1F
- Reference
- Crouch, J.A., Tredway, L.P., Clarke, B.B., Hillman, B.I. (2009) Phylogenetic and population genetic divergence correspond with habitat for the pathogen Colletotrichum cereale and allied taxa across diverse grass communities. Molecular Ecology 18: 123–135.
- Literature
- Liu, F., Ma, Z.Y., Hou, L.W., Diao, Y.Z., Wu, W.P., Damm, U., Song, S. and Cai, L. (2022) Updating species diversity of Colletotrichum, with a phylogenomic overview. Studies in Mycology 101: 1–56.
- Reference Strain
Colletotrichum eleusines MAFF 511155 Colletotrichum hanaui MAFF 305404 Colletotrichum miscanthi MAFF 510857 Colletotrichum nicholsonii MAFF 511115 Colletotrichum paspali MAFF 305403 Colletotrichum zoysiae MAFF 238573, MAFF 238574, MAFF 238576