Primer Detail
- Primer name
- TM-R
- Gene name
- IGS
- Primer sequence (5'-3')
- TCATTCTTGATCCACTAGTC
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- 3F
- Reference
- Misawa, T., Kuninaga, S. (2010) The first report of tomato foot rot caused by Rhizoctonia solani AG-3 PT and AG-2-Nt and its host range and molecular characterization. Journal of General Plant Pathology 76: 310-319.
- Literature
- Kuninaga, S., Sayama, A., Yokosawa, R. (2007) Rhizoctonia solani strains associated with a leaf blight of tomato are classified into a new subgroup within AG-3 (Abstract in Japanese). 73: 184.