Primer Detail
- Primer name
- WB-B(B-BR)
- Gene name
- ITS
- Primer sequence (5'-3')
- GGACTATTAGAAGCGGTTCG
- Direction
- R
- Category
- specific primer
- Target
- fungi
- Paired primer
- WB-B(B-BF)
- Reference
- Godoy-Lutz, G., Kuninaga, S., Steadman, J.R., Powers, K. (2008) Phylogenetic analysis of Rhizoctonia solani subgroups associated with web blight symptoms on common bean based on ITS-5.8S rDNA. Journal of General Plant Pathology 74: 32-40.