Primer Detail
- Primer name
- 3cYp-R
- Gene name
- caf1 (caf1)
- Primer sequence (5'-3')
- TGGGATCACCCGCGGCATCTG
- Direction
- R
- Category
- specific primer
- Target
- Bacteria
- Paired primer
- 3cYp-F
- Reference
- Ezaki, T., Kanazawa, I., Hayashi, S.. Hayashi, M., Eldesoky, I. and Fukunaga, H. (2016) A cocktail PCR and DNA strip method for quick confirmation of multiple pathogenic factors in BSL3 stock cultures. Microbial Resources and Systematics 32: 123-131.