Primer Detail
- Primer name
- 4NFtI-F
- Gene name
- Noncoding4 (Noncoding4)
- Primer sequence (5'-3')
- AGCTTATGCATCGAGTTGAGGTA
- Direction
- F
- Category
- specific primer
- Target
- Bacteria
- Paired primer
- 4NFtI-R
- Reference
- Gunnell, M.K., Lovelace, C.D., Satterfield, B.A., Moore, E.A., O’Neill, K.L. & Robison, R.A. (2012) A multiplex real-time PCR assay for the detection and differentiation of Francisella tularensis subspecies. Journal of Medical Microbiology 61: 1525-1531.
- Literature
- Ezaki, T., Kanazawa, I., Hayashi, S.. Hayashi, M., Eldesoky, I. and Fukunaga, H. (2016) A cocktail PCR and DNA strip method for quick confirmation of multiple pathogenic factors in BSL3 stock cultures. Microbial Resources and Systematics 32: 123-131.