Primer Detail
- Primer name
- 3CSeT-R
- Gene name
- CRISPR1 (CRISPR1)
- Primer sequence (5'-3')
- GCATCATCGCGCATAGTGTC
- Direction
- R
- Category
- specific primer
- Target
- Bacteria
- Paired primer
- 3CSeT-F
- Reference
- Fabre, L., Le Hello, S., Roux, C., Issenhuth-Jeanjean, S. and Weill, F.-X. (2014) CRISPR is an optimal target for the design of specific PCR assays for Salmonella enterica serotypes Typhi and Paratyphi A. PLOS Neglected Tropical Diseases 8: e2671.
- Literature
- Ezaki, T., Kanazawa, I., Hayashi, S.. Hayashi, M., Eldesoky, I. and Fukunaga, H. (2016) A cocktail PCR and DNA strip method for quick confirmation of multiple pathogenic factors in BSL3 stock cultures. Microbial Resources and Systematics 32: 123-131.