Primer Detail
- Primer name
- 5iSeT-F
- Gene name
- invA (invA)
- Primer sequence (5'-3')
- TGACAGAATCCTCAGTTTTTCA
- Direction
- F
- Category
- specific primer
- Target
- Bacteria
- Paired primer
- 5iSeT-R
- Reference
- Hayashi, M., Natori, T., Hayashi, S.K., Miyata, M., Ohkusu, K., Kawamoto, K., Kurazono, H., Makino, S. and Ezaki, T. (2013) A new protocol to detect multiple foodborne pathogens with PCR dipstick DNA chromatography after six-hour enrichment culture in broad-range food pathogen enrichment broth. BioMed Research International 2013: 295050.
- Literature
- Ezaki, T., Kanazawa, I., Hayashi, S.. Hayashi, M., Eldesoky, I. and Fukunaga, H. (2016) A cocktail PCR and DNA strip method for quick confirmation of multiple pathogenic factors in BSL3 stock cultures. Microbial Resources and Systematics 32: 123-131.