Primer Detail
- Primer name
- TSWVcpR
- Gene name
- viral capsid/coat protein gene
- Primer sequence (5'-3')
- AGTTGTACTTTCGCACCTTGA
- Direction
- R
- Category
- specific primer
- Target
- Virus
- Paired primer
- TSWVcpF
- Reference
- Uehara-Ichiki, T., Fuji, S., Sugimoto, R., Ohashi, M., Yabunaka, K., Kitaya, M., Yamashita, K., Hanada, K. and Aoki, T. (2016) Detection and application of viral capsid/coat protein genes of plant viruses preserved in the NARO Genebank (MAFF). Microbial Resources and Systematics 32: 39-47.
- Reference Strain
Tospovirus Tomato spotted wilt virus MAFF 104085, MAFF 260050, MAFF 260145, MAFF 260146, MAFF 260147, MAFF 260148, MAFF 260149