Primer Detail
- Primer name
- ToMVcpF
- Gene name
- viral capsid/coat protein gene
- Primer sequence (5'-3')
- TTTGATTGAAGATGAAGCCGA
- Direction
- F
- Category
- specific primer
- Target
- Virus
- Paired primer
- ToMVcpR
- Reference
- Uehara-Ichiki, T., Fuji, S., Sugimoto, R., Ohashi, M., Yabunaka, K., Kitaya, M., Yamashita, K., Hanada, K. and Aoki, T. (2016) Detection and application of viral capsid/coat protein genes of plant viruses preserved in the NARO Genebank (MAFF). Microbial Resources and Systematics 32: 39-47.
- Reference Strain
Tobamovirus Tomato mosaic virus MAFF 104034, MAFF 260001, MAFF 260002, MAFF 260004, MAFF 260005, MAFF 260006, MAFF 260007, MAFF 260008, MAFF 260009, MAFF 260010, MAFF 260011, MAFF 260012, MAFF 260013, MAFF 260017, MAFF 260022, MAFF 260023, MAFF 260051, MAFF 260052, MAFF 260062