Primer Detail
- Primer name
- CM-F
- Gene name
- MAT1-2-1
- Primer sequence (5'-3')
- TCTACCTCATCGACGCTGCT
- Direction
- F
- Category
- specific primer
- Target
- Colletotrichum gloeosporioides complex
- Paired primer
- CM-R
- Reference
- Diogo Nuno Silva, Pedro Talhinhas, Vítor Várzea, Lei Cai, Octávio Salgueiro Paulo and Dora Batista (2012) Application of the Apn2/MAT locus to improve the systematics of the Colletotrichum gloeosporioides complex: an example from coffee (Coffea spp.) hosts. Mycologia 104: 396-409.