Primer Detail
- Primer name
- Mat1Ar
- Gene name
- MAT1-1; MAT1-2
- Primer sequence (5'-3')
- GTGGGATGTTGTCTTGAAGG
- Direction
- R
- Target
- Pleospora tarda
- Reference
- Patrik Inderbitzin, Jennifer Harkness, B Gillian Turgeon and Mary L Berbee (2005) Lateral transfer of mating system in Stemphylium. Proceedings of the National Academy of Sciences of the United States of America 102: 11390-11395.