Primer Detail
- Gene name
- ITS1
- Primer sequence (5'-3')
- GCTGCTTAATTGTAGTCTGCC
- Category
- specific primer
- Reference
- AM Bailey, DJ Mitchell, KL Manjunath, G Nolasco and CL Niblett (2002) Identification to the species level of the plant pathogens Phytophthora and Pythium by using unique sequences of the ITS1 region of ribosomal DNA as capture probes for PCR ELISA. FEMS Microbiology Letters 207: 153-158.