Primer Detail
- Primer name
- PINF
- Primer sequence (5'-3')
- CTCGCTACAATAGGAGGGTC
- Direction
- R
- Category
- specific primer
- Paired primer
- ITS5
- Reference
- CL Trout, JB Ristaino, M Madritch and T Wangsomboondee (1997) Rapid detection of Phytophthora infestans in Late blight-infected potato and tomato using PCR. Plant Disease 81: 1042-1048.
- Literature
- Judelson HS and Tooley PW. (2000) Enhanced polymerase chain reaction methods for detecting and quantifying Phytophthora infestans in plants. Phytopathology 90: 1112-1119.