Primer Detail
- Primer name
- LB-Z
- Gene name
- LSU
- Primer sequence (5'-3')
- AAAAATGGCCCACTAGAAACT
- Direction
- R
- Category
- specific primer
- Target
- Basidiomycota
- Paired primer
- LR0R
- Reference
- Leho Tederso, Teele Jairus, Bryony M Horton, Kessy Abarenkov, Triin Suvi, Irja Saar and Urmas Kõljalg (2008) Strong host preference of ectomycorrhizal fungi in a Tasmanian wet sclerophyll forest as revealed by DNA barcoding and taxon-specific primers. New Phytologist 180: 479-490.