Primer Detail
- Primer name
- IIV7F
- Gene name
- ITS
- Primer sequence (5'-3')
- GTATCGTCTTGGCGGAGTGG
- Direction
- F
- Category
- specific primer
- Paired primer
- ABA1R
- Reference
- KL Schroeder, PA Okubara, JT Tambong, CA Lévesque and TC Paulitz (2006) Identification and quantification of pathogenic Pythium spp. from soils in eastern washington using real-time polymerase chain reaction. Phytopathology 96: 637-647.
- Literature
- Schroeder KL, Martin F, de Cock AWAM, Lévesque CA, Spies C Okubara P and Paulitz TC (2013) Molecular detection and quantification of Pythium species - Evolving taxonomy, new tools and challenges. Plant Disease 97: 4-20.