Primer Detail
- Primer name
- ITS1-F_KYO2
- Gene name
- ITS1-5.8S-ITS2 rRNA gene
- Primer sequence (5'-3')
- TAGAGGAAGTAAAAGTCGTAA
- Direction
- F
- Category
- specific primer
- Target
- fungi
- Reference
- Toju H, Tanabe AS, Yamamoto S and Sato H (2012) High-coverage ITS primers for the DNA-based identification of ascomycetes and basidiomycetes in environmental samples. PLoS One 6: e40863.
- Literature
- Kohmei Kadowaki, Hirotoshi Sato, Satoshi Yamamoto, Akifumi S. Tanabe, Amane Hidaka and Hirokazu Toju (2014) Detection of the horizontal spatial structure of soil fungal communities in a natural forest. Population Ecology 56: 301-310.