Primer Detail
- Primer name
- SUB2
- Gene name
- calmodulin region
- Primer sequence (5'-3')
- CAGTATGGACGTTGGTATTATATCTAA
- Direction
- R
- Category
- specific primer
- Reference
- Mulè G, Susca A, Stea G and Moretti A (2004) A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. European Journal of Plant Pathology 110: 495-502.