Primer Detail
- Primer name
- NPIGS-R
- Gene name
- intergenic spacer region of rRNA gene (IGS)
- Primer sequence (5'-3')
- ACCCTAGAGTATACACTAAACT
- Direction
- R
- Category
- specific primer
- Reference
- Wang C, Lin Y, Lin Y and Chung W (2013) Modified primers for the identification of nonpathogenic Fusarium oxysporum isolates that have biological vontrol potential against Fusarium wilt of cucumber in Taiwan. PLoS One 8: e65093.