Primer Detail
- Primer name
- FIGS12
- Gene name
- intergenic spacer region of rRNA gene (IGS)
- Primer sequence (5'-3')
- GCAAAATTCAATAGTATGGC
- Direction
- R
- Category
- general
- Target
- fungi
- Reference
- Mulè G, Susca A, Stea G and Moretti A (2004) A species-specific PCR assay based on the calmodulin partial gene for identification of Fusarium verticillioides, F. proliferatum and F. subglutinans. European Journal of Plant Pathology 110: 495-502.
- Literature
- Wang C, Lin Y, Lin Y and Chung W (2013) Modified primers for the identification of nonpathogenic Fusarium oxysporum isolates that have biological vontrol potential against Fusarium wilt of cucumber in Taiwan. PLoS One 8: e65093.
- Kawabe M, Kobayashi Y, Okada G, Yamaguchi I, Teraoka T and Arie T (2005) Three evolutionary lineages of tomato wilt pathogen, Fusarium oxysporum f. sp. lycopersici, based on sequences of IGS, MAT1, and pg1, are each composed of isolates of a single mating type and a single or closely related vegetative compatibility group. Journal of General Plant Pathology 71: 263-272.
- Reference Strain
Fusarium oxysporum f. sp. batatas MAFF 103070 Fusarium oxysporum f. sp. lycopersici MAFF 103043, MAFF 305121, MAFF 727501, MAFF 744006 Fusarium oxysporum f. sp. lycopersici race 1 MAFF 103036 Fusarium oxysporum f. sp. lycopersici race 2 MAFF 103038 Fusarium oxysporum f. sp. melongenae MAFF 103051 Fusarium oxysporum f. sp. niveum MAFF 305608 Fusarium oxysporum f. sp. radicis-lycopersici MAFF 103044, MAFF 103047