Primer Detail
- Primer name
- B6003
- Gene name
- FOW1
- Primer sequence (5'-3')
- TCTACGACACTCCCAAAGTC
- Direction
- F
- Category
- specific primer
- Reference
- Inoue I, Namiki F and Tsuge T (2002) Plant colonization by the vascular wilt fungus Fusarium oxysporum requires FOW1, a gene encoding a mitochondrial protein. Plant Cell 14: 1869-1883.
- Literature
- Li Y, Garibaldi A and Gullino ML (2010) Molecular detection of Fusarium oxysporum f. sp. chrysanthemi on three host plants: Gerbera jamesonii, Osteospermum sp. and Argyranthemum frutescens. Journal of Plant Pathology 92: 525-530.