Primer Detail
- Primer name
- FS2
- Primer sequence (5'-3')
- AGTAAACTCCGACAGGTGCAA
- Direction
- R
- Category
- specific primer
- Reference
- Casasnovas F, Fantini EN, Palazzini JM, Giaj-Merlera G, Chulze SN, Reynoso MM and Torres AM (2013) Development of amplified fragment length polymorphism (AFLP)-derived specific primer for the detection of Fusarium solani aetiological agent of peanut brown root rot. Journal of Applied Microbiology 114: 1782-1792.